View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11236_high_6 (Length: 515)
Name: NF11236_high_6
Description: NF11236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11236_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 436; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 436; E-Value: 0
Query Start/End: Original strand, 16 - 508
Target Start/End: Complemental strand, 29032897 - 29032405
Alignment:
| Q |
16 |
gttttgaacaaaaggtggaaccacgcaagggttagggtttgaacaagtgtggttaagaaaatcaccactgttgaacttagtgacatggcggtgttgagat |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29032897 |
gttttgaacaaaaggtggaaccaaacaagggttagggtttgaacaagtgtggttaagaaaatcaccactgttgaacttagtgacatggcggtgttgagat |
29032798 |
T |
|
| Q |
116 |
ttttgctgcttatgattatggcatggatgaagaaggttttgttcggtggtttcgggatagaagaaattggttcgagctttggaaccgcgcatggatagag |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29032797 |
ttttgctgcttatgattatggaatggatgaagaaggttttgttcggttgtttcgggatagaagaaattggttcgagctttggaaccgcgcatggatagag |
29032698 |
T |
|
| Q |
216 |
cggcggagtcgtaggcgcaagcagcttgttcggcggtatcgaaagttccgagccagcggcgttctttggaatgtgggtctcttatctcggctgcataacg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29032697 |
cggcggagtcgtaggcgcaagcagcttgttcggcggtatcgaaagttccgagccagcggcgttctttggaatgtgggtctcttatctcggctgcataacg |
29032598 |
T |
|
| Q |
316 |
gccccatggtcggcgtcggactccacggtatcgtaccgtggcgcctgttttgttggttgcagaagtggaagaggaagaggaagnnnnnnngtggtggtgg |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29032597 |
gccccatggtcggcgtcggactccacggtatcgtaccgtggcgccagttttgttggttgcagaagtggaagaggaagaggaagtttttttgtggtggtgg |
29032498 |
T |
|
| Q |
416 |
tggttttctggttcttccattggaggcattccgttgagagttcttagtgcttgttccatggtatggaaagattgaaaataattatgctctgtg |
508 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29032497 |
tggttgtcttgttcttccattggaggcattccgttgagagttcttagtgcttgttccatggtatggaaagatttgaaataattatgctctgtg |
29032405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 254 - 345
Target Start/End: Complemental strand, 14158661 - 14158570
Alignment:
| Q |
254 |
tcgaaagttccgagccagcggcgttctttggaatgtgggtctcttatctcggctgcataacggccccatggtcggcgtcggactccacggta |
345 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| || |||||||||||||| |||||||| ||||||||||||| ||| || ||||| ||||| |
|
|
| T |
14158661 |
tcgaaggttccaagccagcggcgttctttggactgagggtctcttatctcagctgcatagcggccccatggtctgcggcgaactccgcggta |
14158570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University