View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11236_low_1 (Length: 927)
Name: NF11236_low_1
Description: NF11236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11236_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 51; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 441 - 499
Target Start/End: Complemental strand, 19230906 - 19230848
Alignment:
| Q |
441 |
ttttatgctaaaccagtacacaatgagatatataacacctaaaaagagcttagaacatt |
499 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19230906 |
ttttatggtaaaccagtacacaatgagatatataacacctaaaaagagcttaaaacatt |
19230848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University