View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11236_low_1 (Length: 927)

Name: NF11236_low_1
Description: NF11236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11236_low_1
NF11236_low_1
[»] chr1 (1 HSPs)
chr1 (441-499)||(19230848-19230906)


Alignment Details
Target: chr1 (Bit Score: 51; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 441 - 499
Target Start/End: Complemental strand, 19230906 - 19230848
Alignment:
441 ttttatgctaaaccagtacacaatgagatatataacacctaaaaagagcttagaacatt 499  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||    
19230906 ttttatggtaaaccagtacacaatgagatatataacacctaaaaagagcttaaaacatt 19230848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University