View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11236_low_10 (Length: 429)
Name: NF11236_low_10
Description: NF11236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11236_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 18 - 411
Target Start/End: Complemental strand, 38771212 - 38770834
Alignment:
| Q |
18 |
agaaacacatgaagaagctaagaaaacttcacaagaaactagtaaaatcaatgaaccaactgttgtgaaacaaaataaaaatgatgttgcagctgaggtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38771212 |
agaaacacatgaagaagctaagaaaacttcacaagaaactagtaaaatcaatgaaccagctgttgtgaaacaaaataaaaatgatgttgcagctgaggtg |
38771113 |
T |
|
| Q |
118 |
aatatagaaacagcagaagctgaaacaaaaagcaatgagttgaacgaaccaatcaaactagaaaaatcatctgagactattcacattgaaaatgtggtgg |
217 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38771112 |
aagatagaaacaccagaagctgaaacaaaaagcaatgagttgaacgaaccaatcaaactagaaaaatcatctgagact---------------gtggtgg |
38771028 |
T |
|
| Q |
218 |
ttcctccggctgaggagaaagtgattgaagtggttttaacaaaagcagaatctgtggataacaaagtagtggaagcaacatctagcatagaagatatatc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38771027 |
ttcctccggctgaggagaaagtgattgaagtggttttaacaaatgcagaatctgtggataacaaagtagtggaagcaacatctagcatagaagatatatc |
38770928 |
T |
|
| Q |
318 |
caaggcttctgatgttggttggcagcagtgataaagcttccatctcttaatccaaccggctgcaccgtgtagctgcaaagtcgtcgtctgtgct |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38770927 |
caaggcttctgatgttggttggcagcagtgataaagcttccatctcttgatccaaccggctgcaccgtgtagctgcaaagtcgtcgtctgtgct |
38770834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University