View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11236_low_16 (Length: 325)
Name: NF11236_low_16
Description: NF11236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11236_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 20 - 308
Target Start/End: Complemental strand, 34613732 - 34613444
Alignment:
| Q |
20 |
tcatgtcttcagatgaagaatgttgttgtggttgagatatgatatcaatactatgagatgcagactctacacaagtaatgtaaaaagcttgagttccttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34613732 |
tcatgtcttcagatgaagaatgttgttgtggttgagatatgatatcaatactatgagatgcagactctgcacaagtaatgtaaaaagcttgagttccttt |
34613633 |
T |
 |
| Q |
120 |
gcctgagtatgggaaataaggtggaaagccatgcttcttgtaacaagtttctatcatacgactaggccttcgattctaccctataaccaggccttcgaca |
219 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34613632 |
gtctgagtatgggaaataaggtggaaagccatgcttcttgtaacaagtttctaccatacgactaggccttcgattctaccctataaccaggccttcgaca |
34613533 |
T |
 |
| Q |
220 |
gaatgtgcagattttgcaggatcacggctgccgccacaaccgggattaccacggcctccaccagcagcagaatcaatcatagcagaaat |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34613532 |
gaatgtgcagattttgcaggatcacggctgccgccacaaccgggattaccacggcctccaccagcagcagaatcaatcatagcagaaat |
34613444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University