View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11237_high_15 (Length: 240)
Name: NF11237_high_15
Description: NF11237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11237_high_15 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 104 - 240
Target Start/End: Complemental strand, 504828 - 504692
Alignment:
| Q |
104 |
gagcgacaaattgctataataaaaggttcagttgctactattttgtcttcttcaaacttgtttctaaattgtgagattgtttacctaataattgggtggt |
203 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
504828 |
gagcaacaaattgctataataaaaggttcagttgctactattttgtcttcttcaaacttgtttctaaattgtgagattgtttgcctaataattgggtggt |
504729 |
T |
|
| Q |
204 |
ttcactcactacttcctatatcacccacatacccatc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
504728 |
ttcactcactacttcctatatcacccacatacccatc |
504692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 17 - 75
Target Start/End: Complemental strand, 504913 - 504855
Alignment:
| Q |
17 |
accattcagttagtagtaaattaatagagaaaattggtatgatttcttgatgctgtctc |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
504913 |
accattcagttagtagtaaattaatagagaaaattggtatgatttcttgatgctgtctc |
504855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University