View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11237_high_7 (Length: 350)

Name: NF11237_high_7
Description: NF11237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11237_high_7
NF11237_high_7
[»] chr6 (1 HSPs)
chr6 (119-243)||(893309-893434)
[»] scaffold0179 (1 HSPs)
scaffold0179 (102-210)||(23974-24082)
[»] chr1 (1 HSPs)
chr1 (150-202)||(51092895-51092947)


Alignment Details
Target: chr6 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 119 - 243
Target Start/End: Original strand, 893309 - 893434
Alignment:
119 ggtacatgtcaactgctatttcactgttggctggccttgcgccggcctgatgcaccgtttccatcacaacctttactctcttttctaccgtc-nnnnnnn 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            
893309 ggtacatgtcaactgctatttcactgttggctggccttgcgccggcctgatgcaccgtttccatcacaacctttactctcttttctaccgtctttttttt 893408  T
218 attgtagcggctctcatccgtacttc 243  Q
    ||||||||||||||||||||||||||    
893409 attgtagcggctctcatccgtacttc 893434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 102 - 210
Target Start/End: Complemental strand, 24082 - 23974
Alignment:
102 ggtcctgcctacaccatggtacatgtcaactgctatttcactgttggctggccttgcgccggcctgatgcaccgtttccatcacaacctttactctcttt 201  Q
    |||||||||||||||||||||||||||||||||| ||||||| || | |||||||||| |||  ||||||||||||||||||||||||||||||||||||    
24082 ggtcctgcctacaccatggtacatgtcaactgctctttcactttttgttggccttgcgtcggtttgatgcaccgtttccatcacaacctttactctcttt 23983  T
202 tctaccgtc 210  Q
    ||| |||||    
23982 tctcccgtc 23974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 51092947 - 51092895
Alignment:
150 tggccttgcgccggcctgatgcaccgtttccatcacaacctttactctctttt 202  Q
    |||||| ||||||||||||||||| ||||||||||||||||||  ||||||||    
51092947 tggcctcgcgccggcctgatgcactgtttccatcacaacctttcatctctttt 51092895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University