View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11237_high_9 (Length: 324)
Name: NF11237_high_9
Description: NF11237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11237_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 305
Target Start/End: Original strand, 4114614 - 4114901
Alignment:
| Q |
19 |
gttgtaacgtgtaatctcgtacttacacatatgttttattatttctct--gttctctttttacctaatcttcttgctaagcaaactccaagcacaagcct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
4114614 |
gttgtaacgtgtaatctcgtacttacacatatgttttattatttctctatgttctctttttacctaatct-cttgctaagcaaactccaagcacatgcct |
4114712 |
T |
|
| Q |
117 |
tgtccatgtagaaacattagtattacttattttaatgtccttattcaatttggccgaaagcatagtatcgaatatgaagattatttattggttttttcac |
216 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4114713 |
tgtccatgtagaaacattagtatcagttattttaatgtccttattcaatttggccgaaagcatagtatcgaatatgaagattatttattggttttttcac |
4114812 |
T |
|
| Q |
217 |
ggcgcatgtatatttatacgtcgatgtttgaatgtggatcatttatagagattaacaaagctaatttatatgcctagaatgagcatcac |
305 |
Q |
| |
|
||||||||||||||||||||||||| || |||||| ||||||||||||||||||||||||| |||||||||||| ||| |||||||| |
|
|
| T |
4114813 |
agcgcatgtatatttatacgtcgatgattcaatgtgaatcatttatagagattaacaaagcttatttatatgcctgtaatcagcatcac |
4114901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University