View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11237_low_7 (Length: 350)
Name: NF11237_low_7
Description: NF11237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11237_low_7 |
 | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 119 - 243
Target Start/End: Original strand, 893309 - 893434
Alignment:
| Q |
119 |
ggtacatgtcaactgctatttcactgttggctggccttgcgccggcctgatgcaccgtttccatcacaacctttactctcttttctaccgtc-nnnnnnn |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
893309 |
ggtacatgtcaactgctatttcactgttggctggccttgcgccggcctgatgcaccgtttccatcacaacctttactctcttttctaccgtctttttttt |
893408 |
T |
|
| Q |
218 |
attgtagcggctctcatccgtacttc |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
893409 |
attgtagcggctctcatccgtacttc |
893434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 102 - 210
Target Start/End: Complemental strand, 24082 - 23974
Alignment:
| Q |
102 |
ggtcctgcctacaccatggtacatgtcaactgctatttcactgttggctggccttgcgccggcctgatgcaccgtttccatcacaacctttactctcttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| || | |||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24082 |
ggtcctgcctacaccatggtacatgtcaactgctctttcactttttgttggccttgcgtcggtttgatgcaccgtttccatcacaacctttactctcttt |
23983 |
T |
|
| Q |
202 |
tctaccgtc |
210 |
Q |
| |
|
||| ||||| |
|
|
| T |
23982 |
tctcccgtc |
23974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 51092947 - 51092895
Alignment:
| Q |
150 |
tggccttgcgccggcctgatgcaccgtttccatcacaacctttactctctttt |
202 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
51092947 |
tggcctcgcgccggcctgatgcactgtttccatcacaacctttcatctctttt |
51092895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University