View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11237_low_8 (Length: 344)
Name: NF11237_low_8
Description: NF11237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11237_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 504627 - 504294
Alignment:
| Q |
1 |
tttgagaatcaaataaattaaccaaaaatggaaaatagaaaccagagtaattaatgcaacaataaaatgcatatattattagtttaatcttacaaggtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
504627 |
tttgagaatcaaataaattaaccaaaaatggaaaatagaaaccagagtaattaatgcaacaataaaatgcatatattattaggttaatcttacaaggtgg |
504528 |
T |
 |
| Q |
101 |
caaagaaaatgagaacccttttaggatcaagtgtccatgaagaagatcgtatgaaactatttcggcgagttaatctgctttcaccagtggtggcggtggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
504527 |
caaagaaaatgagaacccttttaggatcaagtgtccatgaagaagatcgtatgaaactatttcggcgagttaatctgctttcaccggtggtggcggtggt |
504428 |
T |
 |
| Q |
201 |
ggtgccgatgatgttaatctgatgatgattgtgtgggttgatggaatgatccggggaccccgctgccattgccgttggcgtacatgaccctgccatagta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
504427 |
ggtgccgatgatgttaatctgatgatgattgtgtgggttgatggaatgatccggggaccccgctgccattgccgttggcgtacatgaccctgccatagta |
504328 |
T |
 |
| Q |
301 |
gttacaacacttcaa---tgatacacacaccttc |
331 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |
|
|
| T |
504327 |
gttacaacacttcaatgatgatacacacaccttc |
504294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University