View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11238_high_14 (Length: 308)

Name: NF11238_high_14
Description: NF11238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11238_high_14
NF11238_high_14
[»] chr7 (2 HSPs)
chr7 (212-297)||(7152280-7152365)
chr7 (1-32)||(7152429-7152460)


Alignment Details
Target: chr7 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 212 - 297
Target Start/End: Complemental strand, 7152365 - 7152280
Alignment:
212 agacctggtgattctcaagtggatgccgttttgatccaatggtcgaatttgttagcttctaccaatgctttcccatattccttcat 297  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
7152365 agacctggtgattctcaagtggatgccgttttgatccaatggtcgaatttgttagcttctaccaatgctttcccagattccttcat 7152280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 7152460 - 7152429
Alignment:
1 ttttggtacgggaggaagagaactttactgat 32  Q
    ||||||||||||||||||||||||||||||||    
7152460 ttttggtacgggaggaagagaactttactgat 7152429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University