View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11238_high_17 (Length: 277)
Name: NF11238_high_17
Description: NF11238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11238_high_17 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 104 - 277
Target Start/End: Complemental strand, 37504297 - 37504124
Alignment:
| Q |
104 |
gagggttattgttgatcatcccatatggtttatccgtactgtagggcttcaacgatcggtgatagattccattacagtcttcaaatacggaaaagacgaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37504297 |
gagggttattgttgatcatcccatatggttcatccgtacggtagggcttcaacgatcggtgatagattccattacagtcttcaaatacagaaaagacgaa |
37504198 |
T |
 |
| Q |
204 |
ggactcgttgatgggacagagtgttctgtttgtctaggtgaatttcaagaggaagagagtctcagaattttgcc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37504197 |
ggactcgttgatgggacagagtgttctgtttgtctaggtgaatttcaagaggaagagagtctcagaattttgcc |
37504124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 72
Target Start/End: Complemental strand, 37504386 - 37504329
Alignment:
| Q |
15 |
agaagaaacacgccggtattgtttgatgtccatggttatagagattctacaatttcaa |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37504386 |
agaagaaacacgccggtattgtttgatgtccatggttatagagattctacaatttcaa |
37504329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University