View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11238_high_25 (Length: 240)
Name: NF11238_high_25
Description: NF11238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11238_high_25 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 12810545 - 12810323
Alignment:
| Q |
18 |
agtttatgaatgactcatcactattgctttcataaagtcttagaaattgttgaaataccgacatgaaataaatttcaacaattactagcgttatttgcac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12810545 |
agtttatgaatgactcatcactattgctttcataaagtcttagaaattgttgaaataccaacatgaaataaatttcaacaattactagcgttatttgcac |
12810446 |
T |
|
| Q |
118 |
cacaattactagtgatgacaacatgcttttaacgatgccttttaccaaagaggaatttcgtgcgacgatgttctctttgcaccctcgcaaatgtcttgat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
12810445 |
cacaattactagtgatgacaacatgcttttaacgacgccttttaccaaagaggagtttcgtgcgacgttgttctctttgcaccctcacaaatgtcttgat |
12810346 |
T |
|
| Q |
218 |
ccggatggttataaaccatgttt |
240 |
Q |
| |
|
|||||||||||||| ||| |||| |
|
|
| T |
12810345 |
ccggatggttataatccaggttt |
12810323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 12747461 - 12747239
Alignment:
| Q |
18 |
agtttatgaatgactcatcactattgctttcataaagtcttagaaattgttgaaataccgacatgaaataaatttcaacaattactagcgttatttgcac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12747461 |
agtttatgaatgactcatcactattgctttcataaagtcttagaaattgttgaaataccaacatgaaataaatttcaacaattactagcgttatttgcac |
12747362 |
T |
|
| Q |
118 |
cacaattactagtgatgacaacatgcttttaacgatgccttttaccaaagaggaatttcgtgcgacgatgttctctttgcaccctcgcaaatgtcttgat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
12747361 |
cacaattactagtgatgacaacatgcttttaacaacgccttttaccaaagaggagtttcgtgcgacgttgttctctttgcaccctcacaaatgtcttgat |
12747262 |
T |
|
| Q |
218 |
ccggatggttataaaccatgttt |
240 |
Q |
| |
|
|||||||||||||| ||| |||| |
|
|
| T |
12747261 |
ccggatggttataatccaggttt |
12747239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University