View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11238_high_28 (Length: 236)
Name: NF11238_high_28
Description: NF11238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11238_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 45641393 - 45641185
Alignment:
| Q |
19 |
attctttggaacaaaaatcattcttctctaataaactcttcaacatagaatgagtaaatttaggatcattagggtcactaccagttgacccattagggtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45641393 |
attctttggaacaaaaatcattcttctctaataaactcttcaacatagaatgagtaaatttaggatcattagggtcactactagttgacccattagggtt |
45641294 |
T |
 |
| Q |
119 |
ttccaatacatttggacgcgaaaaacaaaacttgcaaccaaatccatttcgagtagtagtactattatgaccctcaccttgaataatcaccaccttacct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45641293 |
ttccaatacatttggacgcgaaaaacaaaacttgcaaccaaatccatttcgagtagtagtactattatgaccctcaccttgaataatcaccaccttacct |
45641194 |
T |
 |
| Q |
219 |
atgctactc |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
45641193 |
ctgctactc |
45641185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University