View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11238_low_13 (Length: 320)
Name: NF11238_low_13
Description: NF11238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11238_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 35974134 - 35974289
Alignment:
| Q |
1 |
ctagtgaaacttggatcaagaaacttctttctgtgtcctaaaaatactgcacacgcaggggagggtatttctggaaatagaaatgatggtagcgtaacga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35974134 |
ctagtgaaacttggatcaagaaacttctttctgtgtcctaaaaatactgcacacgcaggggagggtatttctggaaatagaaatgatggtagcgtaacga |
35974233 |
T |
|
| Q |
101 |
caacgtttccggcttcgtcgtgtgctaatgaggttgacaaagctcgagaatatgta |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35974234 |
caacgtttccggcttcgtcgtgtgctaatgaggttgacaaagctcgagaatatgta |
35974289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 192 - 304
Target Start/End: Original strand, 35974328 - 35974440
Alignment:
| Q |
192 |
caaactcatgcatttcatgcaataattgcttaatggttagttaaaatgaaaataatttattgttttagtttgctttgatcaaatgaattgccagttagtt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35974328 |
caaactcatgcatttcatgcaataattgcttaatggttagttaaaatgaaaataatttattgttttagtttgctttgatcaaatgaattgcctgttagtt |
35974427 |
T |
|
| Q |
292 |
tgtataaaaatag |
304 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35974428 |
tgtataaaaatag |
35974440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University