View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11238_low_20 (Length: 268)
Name: NF11238_low_20
Description: NF11238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11238_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 31 - 203
Target Start/End: Complemental strand, 25339864 - 25339692
Alignment:
| Q |
31 |
gacaatgacacgttgataattgcttttagtccttgtaagcaattttctacatggaccaacattgttaaaacaaaaacttttatcgcttccattaggtcta |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25339864 |
gacaatgacacgttgataattgcttttagtccttgtaagcaattttctacatggaccaacattgttaaaacaaaaacttttatcgcttccattaggtcta |
25339765 |
T |
|
| Q |
131 |
atgcaagtaattggtgcgcaatgcatgtgtgtattataaatctttgaggtaccgagtacgattcctactcatc |
203 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
25339764 |
atgcaagtgattggtgcgcaatgcatgtgtgtattataaatctctgaggtaccgagtacgatttctactcatc |
25339692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University