View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11238_low_35 (Length: 232)
Name: NF11238_low_35
Description: NF11238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11238_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 214
Target Start/End: Complemental strand, 11313364 - 11313167
Alignment:
| Q |
17 |
cagagcctgtaaacttgcaagccaaacacatcatgtcttcaagcattaccaacacatcccttccaaaaacagaaccagaacttagcatccaatcattcca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11313364 |
cagagcctgtaaacttgcaagccaaacacatcatgtcttcaagcattaccaacacatccctcccaaaaacagaaccagaacttagcatccaatcatttca |
11313265 |
T |
 |
| Q |
117 |
ccaatgttcaagttttatctccatgaaactgagcacaaacaatttcatattgtggcgtaatcaaatcacacccttagttcgaagtctcggtgttcttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11313264 |
ccaatgttcaagttttatctccatgaaactgagcacaaacaatttcatattgtggcgtaatcaaatcacacccttagttcgaagtctcggtgttcttc |
11313167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University