View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11239_high_3 (Length: 332)
Name: NF11239_high_3
Description: NF11239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11239_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 50484871 - 50485114
Alignment:
| Q |
18 |
atgaattttgctcttaattgcttcaatttgagatgaaatttcagagtttttgttggnnnnnnnnnnnnata-----aagaattcatggcatggtacgcat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
50484871 |
atgaattttgctcttaattgcttcaatttgagatgaaatttcagagtttttgttggttttgataatatatataataaagaattcatggcatggtacgcat |
50484970 |
T |
 |
| Q |
113 |
gtcaaatttaaaatacacaaaataaacaacctgtacgtggttagtgtttgatagaatagaatagaacacgtaaagaagaattgcaatcaaccaatttcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50484971 |
gtcaaatttaaaatacacaaaataaacaacctgtacgtggttagtgtttgatag-----aatagaacacgtaaagaagaattgcaatcaaccaatttcat |
50485065 |
T |
 |
| Q |
213 |
tcgttcctttatcatgtttttctttaaataacaaaaattagtgattagt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50485066 |
tcgttcctttatcatgtttttctttaaataacaaaaattagtgattagt |
50485114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University