View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11239_high_6 (Length: 238)
Name: NF11239_high_6
Description: NF11239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11239_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 32 - 222
Target Start/End: Complemental strand, 23047796 - 23047606
Alignment:
| Q |
32 |
tccactctgaacaacttcattgattattattttgaaatgacagatagcagatcctgttgaaattgaaaaaatggtggacaaagtgattgcagataatccg |
131 |
Q |
| |
|
|||||||||| |||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
23047796 |
tccactctga-caactttattgattattatttgtaaatgacagataacagatcctgttgaaattgaaaaaatggtggacaaagcgatcgcagataatccg |
23047698 |
T |
 |
| Q |
132 |
aaacaggttgagcaataccgaggaggcaaaacgaaactccaaggnnnnnnngcaggtcaggtatg-acttttagagctggaaacaattgtta |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||| || || |||||||| |||| |||||||||||||| |||||| |
|
|
| T |
23047697 |
aaacaggtcgagcaataccgaggaggcaaaactaaactccaaggtttttttgctggccaggtatgaacttgtagagctggaaacagttgtta |
23047606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University