View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11239_high_7 (Length: 238)
Name: NF11239_high_7
Description: NF11239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11239_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 3521983 - 3521751
Alignment:
| Q |
1 |
cattgcaatacaaggttagttacatattggtcgattagtttggccgattttagaaatagattttgtgcattttgagttccagagggctgaagtatttcca |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
3521983 |
cattgcaatacaaggttagttaaatattggtcgattagtttggccgattttagaaatagattttgtgcattttgagttccagaaggatgaagtatttcca |
3521884 |
T |
 |
| Q |
101 |
tttcaactgttgaaatttggctgctttgtccttattttcatctgtagaggattaataggtcaaagtagcttcccaaaacatgtggtttatatcccaatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3521883 |
tttcaactgttgaaatttggctgctttgtccttattttcatctatagaggattaataggtcaaagtagcttcccaaaacatgtggtttatatcccaatta |
3521784 |
T |
 |
| Q |
201 |
atttatttaacatttctgcatctatcatgttct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3521783 |
atttatttaacatttctgcatctatcatgttct |
3521751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University