View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11239_low_6 (Length: 238)

Name: NF11239_low_6
Description: NF11239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11239_low_6
NF11239_low_6
[»] chr5 (1 HSPs)
chr5 (32-222)||(23047606-23047796)


Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 32 - 222
Target Start/End: Complemental strand, 23047796 - 23047606
Alignment:
32 tccactctgaacaacttcattgattattattttgaaatgacagatagcagatcctgttgaaattgaaaaaatggtggacaaagtgattgcagataatccg 131  Q
    |||||||||| |||||| ||||||||||||||  |||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||||||||||||    
23047796 tccactctga-caactttattgattattatttgtaaatgacagataacagatcctgttgaaattgaaaaaatggtggacaaagcgatcgcagataatccg 23047698  T
132 aaacaggttgagcaataccgaggaggcaaaacgaaactccaaggnnnnnnngcaggtcaggtatg-acttttagagctggaaacaattgtta 222  Q
    |||||||| ||||||||||||||||||||||| |||||||||||       || || |||||||| |||| |||||||||||||| ||||||    
23047697 aaacaggtcgagcaataccgaggaggcaaaactaaactccaaggtttttttgctggccaggtatgaacttgtagagctggaaacagttgtta 23047606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University