View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11239_low_8 (Length: 227)
Name: NF11239_low_8
Description: NF11239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11239_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 19 - 166
Target Start/End: Original strand, 10119964 - 10120111
Alignment:
| Q |
19 |
gttttgccattctttttgttattatatataaataatctcattcaattaagacaacacaagaaaccaacgttatacatgacacatactcacatgctaatgt |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
10119964 |
gttttgccattctttttgttgttatatataaataatctcattcaattaagacaacacaagaaactaacgttatacatgacacataatcacatgctaatgt |
10120063 |
T |
 |
| Q |
119 |
tacaactgcaaccaagattctgcttctaacttctaattaatcatcatc |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10120064 |
tacaactgcaaccaagattctgcttctaacttctaattaatcatcatc |
10120111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University