View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1123_high_26 (Length: 251)
Name: NF1123_high_26
Description: NF1123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1123_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 12836423 - 12836664
Alignment:
| Q |
1 |
catgtgataagggcccttcttccttttgctttgttgcagcagagcttgaggtttgatcctccccatttatcctaatcatcaatttaaagggtcatcaatt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12836423 |
catgtgataacggcccttcttccttttgctttgttgcagcagagcttgaggtttgatcctccccatttatcctaatcatcaatttaaagggtcatcaatt |
12836522 |
T |
 |
| Q |
101 |
ttcagtcaactactcgaacacaagccttccaaatgnnnnnnntattcaaccacaacaaaattatgataaacatcactcataactggtgttgtcaaatagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12836523 |
ttcagtcaactactcgaacacaagccttccaaatgaaaaaaatattcaaccacaacaaaattatgataaacatcactcataaccagtgttgtcaaatagc |
12836622 |
T |
 |
| Q |
201 |
ggctatagaggcgccacagaattttaacaaatcgatattgtt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12836623 |
ggctatagaggcgccacagaattttaacaaatcgatattgtt |
12836664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 9 - 79
Target Start/End: Complemental strand, 42249540 - 42249470
Alignment:
| Q |
9 |
aagggcccttcttccttttgctttgttgcagcagagcttgaggtttgatcctccccatttatcctaatcat |
79 |
Q |
| |
|
|||| |||||||||||||| |||||||| | |||||| |||||||||||||| ||||||| ||||||||| |
|
|
| T |
42249540 |
aaggtcccttcttccttttactttgttgtaacagagcctgaggtttgatcctagccatttaacctaatcat |
42249470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University