View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1123_low_18 (Length: 336)
Name: NF1123_low_18
Description: NF1123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1123_low_18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 105 - 336
Target Start/End: Original strand, 34477648 - 34477879
Alignment:
| Q |
105 |
gttttcacattaatctacttcccctttaacccctttcaaacgttcttcttccctttgcttaatggaaattatgaccaacaacattatcaacaaacaaaac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34477648 |
gttttcacattaatctacttcccctttaacccctttcaaacgttcttcttccctttgcttaatggaaattatgaccaacaacattatcaacaaacaaaac |
34477747 |
T |
|
| Q |
205 |
aacatccattctcaaaagctttcattttggttcgccccaacaactcgtccacccggttttcttcttctctttctcaagtagtagtagtaccatcattgat |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34477748 |
aacatccattctcaaaagctttcattttggttcgccccgacaactcgtccacccggttttcttcttctctttctcaagtagtagtagtaccatcattgat |
34477847 |
T |
|
| Q |
305 |
cacactacgaagtttcagaactatggattact |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34477848 |
cacactacgaagtttcagaactatggattact |
34477879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University