View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1123_low_36 (Length: 253)
Name: NF1123_low_36
Description: NF1123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1123_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 36 - 234
Target Start/End: Original strand, 592956 - 593154
Alignment:
| Q |
36 |
ctcaatgacaaaagagacattaactatatccaagaataacatgatttcatggcaactttaaccacaaagaattggaaagacccaacggaaaatggtggtc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
592956 |
ctcaatgacaaaagagacattaactatatccaagaataacatgatttcatggcaactttaaccacaaagaattggaaagacccaacggaaaatgggggtc |
593055 |
T |
 |
| Q |
136 |
caaaaccagctattgtgccatttaccaaccccnnnnnnntgatttctcataatagggacagtgaaagagagttgtggctacaagaaagactgttacctt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
593056 |
caaaaccagctattgtgccatttaccaaccccaaaaaaatgatttctcataatagggacagtgaaagagagttgtggctacaagaaagactgttacctt |
593154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 36 - 121
Target Start/End: Complemental strand, 44605714 - 44605627
Alignment:
| Q |
36 |
ctcaatgacaaaagagacattaactatatccaagaataacatgatttcatggcaactttaaccac--aaagaattggaaagacccaac |
121 |
Q |
| |
|
||||| |||||| ||||||| || |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
44605714 |
ctcaaagacaaaggagacatcaattatatccaagaataacatgattccatggcaactttaaccacataaagaattggaaagacgcaac |
44605627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University