View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1123_low_39 (Length: 251)
Name: NF1123_low_39
Description: NF1123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1123_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 12836389 - 12836168
Alignment:
| Q |
1 |
cttgtcatatttgtgttttttctctttgctacattcaaatattggtctaataggtcagtaaattgaatgtgaaagctgattcatagtgataaatgatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12836389 |
cttgtcatatttgtgttttttctctttgctacattcaaatattggtctaataggtcagtaaattgaatgtgaaagctgattcatagtgataaatgatatg |
12836290 |
T |
 |
| Q |
101 |
atatatgcaatacattctttgtttcctattttctcattgaatgaattcagaagtgcatcatctgtaatctaataatttataatcttttctgcattcagga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12836289 |
atatatgcaatacattctttgtttcctattttctcatagaatgaattcagaagtgcatcatctgtaatctaataatttataattttttctgcattcagga |
12836190 |
T |
 |
| Q |
201 |
caagatttcaaccagagaacca |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12836189 |
caagatttcaaccagagaacca |
12836168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University