View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1123_low_44 (Length: 234)
Name: NF1123_low_44
Description: NF1123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1123_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 15475048 - 15475183
Alignment:
| Q |
1 |
cgacggagatgtttggtgcagtgatggatttaacagtgtaatgggttgttgcaaatgttgttttgatgccttttgaaactaatctttttgagaattggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15475048 |
cgacggagatgtttggtgcagtgatggatttaacagtgtaatgggttgttgcaaatgttgttttgatgccttttgaaactaatctttttgagaattggat |
15475147 |
T |
|
| Q |
101 |
tagtggactaatgtgtccttgtgctgggtatggaat |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
15475148 |
tagtggactaatgtgtccttgtgctgggtatggaat |
15475183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 15467497 - 15467629
Alignment:
| Q |
1 |
cgacggagatgtttggtgcagtgatggatttaacagtgtaatgggttgttgcaaatgttgttttgatgccttttgaaactaatctttttgagaattggat |
100 |
Q |
| |
|
||||||| | ||||||||| || ||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
15467497 |
cgacggatacgtttggtgcggttatggattgaacagtgtaatgtgttgttgcaaatgttgttttgatgccttttgaaaccaatcgttttgagaattggat |
15467596 |
T |
|
| Q |
101 |
tagtggactaatgtgtccttgtgctgggtatgg |
133 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
15467597 |
tagtggactaatgtgtccttgtgctggatatgg |
15467629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University