View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11240_high_28 (Length: 251)

Name: NF11240_high_28
Description: NF11240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11240_high_28
NF11240_high_28
[»] chr5 (1 HSPs)
chr5 (1-44)||(15302072-15302115)


Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 15302072 - 15302115
Alignment:
1 atactctacttgtatgcatgtgatactgaatacaataactaacg 44  Q
    ||||||||||||||||||||||||||||||| ||||||||||||    
15302072 atactctacttgtatgcatgtgatactgaattcaataactaacg 15302115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University