View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11240_high_30 (Length: 244)
Name: NF11240_high_30
Description: NF11240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11240_high_30 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 244
Target Start/End: Complemental strand, 34638473 - 34638249
Alignment:
| Q |
20 |
atgctcttacgaagaattactgaacatttcaaaggattcttcatttcaagggaaagcttaagactttctgaaagatccacaggtacttgtgctggaagcc |
119 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34638473 |
atgctcttacgaagaactactgaacatttcaaaggattcttcatttcaagggaaagcttaagactttctgaaagatccacaggtacttgtgctggaagcc |
34638374 |
T |
 |
| Q |
120 |
acacaaaattatggagaagttgtgctagccagagatgaaccgtggctaagcctagggctcttcctggacaaaccctacgacctgcaccaaaaggtgcaag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34638373 |
acacaaaattatggagaagttgtgctagccagagatgaaccgtggctaagcctagggctcttcctggacaaaccctacgacctgcaccaaaaggtgcaag |
34638274 |
T |
 |
| Q |
220 |
cctcaagtccgagcccataatagaa |
244 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
34638273 |
cctcaagtccgagcccataacagaa |
34638249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University