View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11240_low_19 (Length: 303)
Name: NF11240_low_19
Description: NF11240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11240_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 6935129 - 6934842
Alignment:
| Q |
1 |
ggtctctttaacgttaatcaactgatgcttaaactacaagattaacatgtttgagtttttagtattgtagataatcacatagtgctagcaaatccctttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6935129 |
ggtctctttaacgttaatcaactgatgctgaaactacaagattaagatgttcgaggttttagtattgtagataatcacatagtgctagcaaatccctttt |
6935030 |
T |
 |
| Q |
101 |
ttggtctctttaacgttaatcaacttataaaggcttcttacaagtgaagttgtttt-aaaagctttttaatagtgctcatttgaactgaaggaagg-aag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6935029 |
ttggtctctttaacgttaatcaacttataaaggcttcttacaagtgaagttgttttaaaaagctttttaatagtgctcatttgaactgaaggaaggaaag |
6934930 |
T |
 |
| Q |
199 |
ccagggagttgatcttgcacattgaaaagcataatttgtatcagacatgctcaaagctttataccaatggtaagtgctcacagtattc |
286 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
6934929 |
ccagggagttgatcttgcacattgaaaggcataatttgtatcagacatgctcaaagctttataccaatggtaagtgctaatagtattc |
6934842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 191 - 232
Target Start/End: Original strand, 6526258 - 6526299
Alignment:
| Q |
191 |
gaaggaagccagggagttgatcttgcacattgaaaagcataa |
232 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||| |||||| |
|
|
| T |
6526258 |
gaaggatgccagggagttgatcttgcacattcaaaggcataa |
6526299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 191 - 232
Target Start/End: Original strand, 6843036 - 6843077
Alignment:
| Q |
191 |
gaaggaagccagggagttgatcttgcacattgaaaagcataa |
232 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||| |||||| |
|
|
| T |
6843036 |
gaaggatgccagggagttgatcttgcacattcaaaggcataa |
6843077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 97 - 125
Target Start/End: Complemental strand, 6935135 - 6935107
Alignment:
| Q |
97 |
ttttttggtctctttaacgttaatcaact |
125 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6935135 |
ttttttggtctctttaacgttaatcaact |
6935107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University