View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11240_low_24 (Length: 272)
Name: NF11240_low_24
Description: NF11240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11240_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 12 - 267
Target Start/End: Original strand, 42777913 - 42778168
Alignment:
| Q |
12 |
gacatcatctacataaatcgtcaacgttgtaaagatagtagaagtccttcttgtgaataaggaatgatgtgatttggattgaatgaaacaaattgagatt |
111 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42777913 |
gacatcatctacataaaccgtcaacgttgtaaagatagtagaagttcttcttatgaataaggaatgatgtgatttggattgaatgaaacaaattgagatt |
42778012 |
T |
 |
| Q |
112 |
agaaaactagatggttaggagaaccattggtgacttgcttgttttaaaccataagagatttcagtaatctgcaaacttgactaggatttgaggaagtcac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42778013 |
agaaaactagatggttaggagaaccattggtgacttgcttgttttaaaccataagagatttcagtaatctgcaaacttgaataggatttgaggaagtcac |
42778112 |
T |
 |
| Q |
212 |
accaagaggaagctttatataaacctcttcattattgttgtgtgtatccctttgct |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42778113 |
accaagaggaagctttatataaacctcttcattattgttgtgtgtatccctttgct |
42778168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University