View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11240_low_38 (Length: 210)

Name: NF11240_low_38
Description: NF11240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11240_low_38
NF11240_low_38
[»] chr3 (4 HSPs)
chr3 (91-180)||(6939308-6939397)
chr3 (57-169)||(6526797-6526909)
chr3 (57-169)||(6848377-6848489)
chr3 (95-169)||(6558078-6558152)
[»] scaffold0425 (1 HSPs)
scaffold0425 (57-169)||(11504-11616)
[»] chr1 (1 HSPs)
chr1 (20-77)||(49618971-49619028)


Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 91 - 180
Target Start/End: Complemental strand, 6939397 - 6939308
Alignment:
91 atgcgagacatgagaaaagaaggcgctggataaattgcatcaatcaattacacggtgaggatgtcatgtggccttttactccagttttca 180  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6939397 atgcgagacatgagaaaagaaggcgctggataaattgcatcaatcaattacacggtgaggatgtcatgtggccttttactccagttttca 6939308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 57 - 169
Target Start/End: Original strand, 6526797 - 6526909
Alignment:
57 attgtctgcttttctttttgtgtcggctcagaaaatgcgagacatgagaaaagaaggcgctggataaattgcatcaatcaattacacggtgaggatgtca 156  Q
    |||||||| ||||||| |||||||  | ||| |||   ||||| |||||||||||| || || || ||||||||||| |||||||| |||||||||||||    
6526797 attgtctgtttttcttcttgtgtcttcccaggaaacatgagacttgagaaaagaagccgatgaattaattgcatcaaccaattacatggtgaggatgtca 6526896  T
157 tgtggccttttac 169  Q
    |||||||||||||    
6526897 tgtggccttttac 6526909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 57 - 169
Target Start/End: Original strand, 6848377 - 6848489
Alignment:
57 attgtctgcttttctttttgtgtcggctcagaaaatgcgagacatgagaaaagaaggcgctggataaattgcatcaatcaattacacggtgaggatgtca 156  Q
    |||||||| ||||||| |||||||  | ||| |||  |||||| |||||||||||| || || || ||||||||||| |||||||| |||||||||| ||    
6848377 attgtctgtttttcttcttgtgtcttcccaggaaacacgagacttgagaaaagaagccgatgaattaattgcatcaaccaattacatggtgaggatgcca 6848476  T
157 tgtggccttttac 169  Q
    |||||||||||||    
6848477 tgtggccttttac 6848489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 95 - 169
Target Start/End: Original strand, 6558078 - 6558152
Alignment:
95 gagacatgagaaaagaaggcgctggataaattgcatcaatcaattacacggtgaggatgtcatgtggccttttac 169  Q
    ||||| |||||||| ||| || || || | |||||||||  ||||||| ||||||||||||||||||||||||||    
6558078 gagacttgagaaaaaaagccgatgaattacttgcatcaacaaattacatggtgaggatgtcatgtggccttttac 6558152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0425 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: scaffold0425
Description:

Target: scaffold0425; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 57 - 169
Target Start/End: Original strand, 11504 - 11616
Alignment:
57 attgtctgcttttctttttgtgtcggctcagaaaatgcgagacatgagaaaagaaggcgctggataaattgcatcaatcaattacacggtgaggatgtca 156  Q
    |||||||| ||||||| |||||||  | ||| |||   ||||| |||||||||||| || || || ||||||||||| |||||||| |||||||||||||    
11504 attgtctgtttttcttcttgtgtcttcccaggaaacatgagacttgagaaaagaagccgatgaattaattgcatcaaccaattacatggtgaggatgtca 11603  T
157 tgtggccttttac 169  Q
    |||||||||||||    
11604 tgtggccttttac 11616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 20 - 77
Target Start/End: Complemental strand, 49619028 - 49618971
Alignment:
20 actttgtgtcccataattcttagtctatttaacattaattgtctgcttttctttttgt 77  Q
    |||||||||| ||||||| | |||||| |||||  |||||||||||||||||||||||    
49619028 actttgtgtcgcataattttcagtctaattaacgataattgtctgcttttctttttgt 49618971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University