View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11241_high_2 (Length: 645)
Name: NF11241_high_2
Description: NF11241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11241_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 588; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 588; E-Value: 0
Query Start/End: Original strand, 14 - 629
Target Start/End: Complemental strand, 31059427 - 31058812
Alignment:
| Q |
14 |
aggccaatcaccaatgaattattacaaaatgaatgatagaatgaagggtaataatctctttccataccttaacttggcgaatggcttcagacaaatcaaa |
113 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31059427 |
aggccaatcacgaatgaattattacaaaatgaatgatagaatgaagggtaataatctctttccgtaccttaacttggcgaatggcttcagacaaatcaaa |
31059328 |
T |
|
| Q |
114 |
aagaggaggtttctccttttgcttaggcttaatgaacaaaggaaaaggaaccttcattttttcatcttcaacagatttcatcattttcttcctcagctga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31059327 |
aagaggaggtttctccttttgcttaggcttaatgaacaaaggaaaaggaaccttcattttttcatcttccacagatttcatcattttcttcctcagctga |
31059228 |
T |
|
| Q |
214 |
tcctccgcctcaattttcctcctctcagtctccattgcatcgacatccaccggtgccttatcgtcgggaagtggcgccactcttacaggataagaaaccg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31059227 |
tcctccgcctcaattttcctcctctcagtctccattgcatcgacatccactggtgccttatcgtcgggaagtggcgccactctcacaggataagaaaccg |
31059128 |
T |
|
| Q |
314 |
gagttattgacggcgcgtcttttacatagcgaatatcctcgcgcgtccaggagcgtggttgttcggggatgggggtgttagaagcttgaggaggcggtgg |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31059127 |
gagttattgacggcgcgtcttttacatagcgaatatcctcgcgcgtccaggcgcgtggttgttcggggatgggggtgttagaagcttgaggaggcggtgg |
31059028 |
T |
|
| Q |
414 |
aggaggttgagtgtcggaggaaggttgggattcgggttcaggtggaggcgggtcttgaggtttgacggggtaggagacgggttggattggaatgggttgt |
513 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31059027 |
aggaggttgagtgtcggaggaaggttgggattcgggttcaggtggaggcgggtcttgaggtttgacggggtaggagacgggttggattggaatgggttgt |
31058928 |
T |
|
| Q |
514 |
tggaagagagggtttgattcggatgaagaagagaaggatctgaagggatgagaaaggggagagtggaaatgggaagggtggttggtgaaacagtggcggc |
613 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31058927 |
tggaagagagggtttgattcggaggaagaagagaaggatctgaagggatgagaaaggggagagtggaaatgggaagggtggttggtgaaacagtggcggc |
31058828 |
T |
|
| Q |
614 |
gagcttgagagagaag |
629 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31058827 |
gagcttgagagagaag |
31058812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University