View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11241_low_21 (Length: 236)
Name: NF11241_low_21
Description: NF11241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11241_low_21 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 41 - 236
Target Start/End: Complemental strand, 43584155 - 43583960
Alignment:
| Q |
41 |
catgcgtttggcttgcaccatttgcacactgctttctgattcgatatgttgtgagcatctgatgtagggtggcggacctgctgccaattatgcaggaaat |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43584155 |
catgcgtttggcttgcaccatttgcacactgctttctgattcgatatgttgcgagcatctgatgtagggtggcggacctgctgccaattatgcaggaaat |
43584056 |
T |
|
| Q |
141 |
cctgtgccagtctgacagaaagttccccctctgcatcctcccagattttcttgttccgtcttttccacaaacacagcattgtaacaaaatcactct |
236 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43584055 |
cctgtgccagtctgacagaaagttcccgctctgcatcctcccagattttcttgttccgtcttttccacaaacacagcattgtaacaaaatcactct |
43583960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University