View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11241_low_23 (Length: 214)
Name: NF11241_low_23
Description: NF11241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11241_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 27750118 - 27749928
Alignment:
| Q |
18 |
gcatattattctctcttttaatatgagccacatgtttgccaatgag--------agataaatcactcttgcacgtttgctagagattatcagccaactcc |
109 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27750118 |
gcatattattctcttatttaatatgagccacatgtttgccaatgagtgaatgagagataaatcactcttgcacgtttgctagagattatcagccaactcc |
27750019 |
T |
 |
| Q |
110 |
tgcgctcttgtgtgttcacttaagaatagatcaatttaatgcacgagtctattactgctgtagatattttttataatttaaggtgtgtgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27750018 |
tgcgctcttgtgtgttcacttaagaatagatcaatttaaagcacgagtctattactgttgtagatattttttataatttaaggtgtgtgtg |
27749928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University