View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11241_low_24 (Length: 210)
Name: NF11241_low_24
Description: NF11241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11241_low_24 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 210
Target Start/End: Complemental strand, 36571253 - 36571057
Alignment:
| Q |
14 |
cctgtggaagcaaactcaatggtatggctggttttgctgagtgcttgcagggtgcattctagtttggatgttgcagaaagagctgcgaaacggatatttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36571253 |
cctgtggaagcaaactcaatggtatggctggttttgctgagtgcttgcagggtgcattctagtttggatgttgcagaaagagctgcgaaacggatatttg |
36571154 |
T |
|
| Q |
114 |
aaatggagcctgattgtagtgctgcctatgtgctgctgtcgaacttgtatgcatcttctagaagatggttggaagttgcaaggattaggatgaaaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36571153 |
aaatggagcctgattgtagtgctgcctatgtgctgctgtcgaacttgtatgcatcttctagaagatggttggaagttgcaaggattaggatgaaaat |
36571057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University