View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11241_low_25 (Length: 203)
Name: NF11241_low_25
Description: NF11241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11241_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 11272957 - 11273048
Alignment:
| Q |
1 |
ccttggatgctttgcagaagggttaggaattggaaactctctggttgctgaattatcaggtgtcatgagatctttgaagatttctaaacata |
92 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11272957 |
ccttggatgctttgctgaagggttgggaattggaaactctctggttgctgaattatcaggtgtcatgagatctttgaagatttctaaacata |
11273048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University