View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11242_low_10 (Length: 374)
Name: NF11242_low_10
Description: NF11242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11242_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 221 - 287
Target Start/End: Original strand, 7357518 - 7357584
Alignment:
| Q |
221 |
agctaccctctttgttaaagactgtgctggaaaaatcaccaccagtttcaactttcaattcatttcc |
287 |
Q |
| |
|
||||||| ||||||||||||||| || |||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
7357518 |
agctaccttctttgttaaagactctgttggaaaaatcaccaccggttttaactttcaattcatttcc |
7357584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 316 - 369
Target Start/End: Original strand, 7357684 - 7357737
Alignment:
| Q |
316 |
tttgtgaaggtttcttcttttgagaaactcatattccgattcctctctgcttct |
369 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||| | |||||| ||||| |
|
|
| T |
7357684 |
tttgtgaaggtttcatcttttgagaaactcagattccgactactctcttcttct |
7357737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 221 - 282
Target Start/End: Original strand, 53722426 - 53722484
Alignment:
| Q |
221 |
agctaccctctttgttaaagactgtgctggaaaaatcaccaccagtttcaactttcaattca |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
53722426 |
agctaccctctttgttaaagactgtgctggaaaaat---caacagtttcaactttcaattca |
53722484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 316 - 362
Target Start/End: Original strand, 53722570 - 53722616
Alignment:
| Q |
316 |
tttgtgaaggtttcttcttttgagaaactcatattccgattcctctc |
362 |
Q |
| |
|
|||||||||||||| |||||||| ||||||| ||| ||||||||||| |
|
|
| T |
53722570 |
tttgtgaaggtttcatcttttgataaactcagatttcgattcctctc |
53722616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University