View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11243_low_10 (Length: 299)
Name: NF11243_low_10
Description: NF11243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11243_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 60 - 283
Target Start/End: Complemental strand, 47112949 - 47112726
Alignment:
| Q |
60 |
tataaaaactaatgacaaataattttttatcaatagacctaaaactatgattttagtaaccttactcttgaaccgatctgacacttttggagagagcttg |
159 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47112949 |
tataaaaattaatgacaaataattttttatcagtagacctaaaacaatgattttagtaaccttactctcgaaccgatctgacacttttggagagagcttg |
47112850 |
T |
|
| Q |
160 |
tcaactcttatgccctaaggctttattgctggcaagaacgaatatgagcttcgagcattggagctgctatatatcaaatgcagatttgaagacttgattt |
259 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47112849 |
tcaactcttatggcctaaggctttattgctggcaagaacgaatatgagcttcgagaattggagctgctatatatcaaatgcagatttgaagacttgattt |
47112750 |
T |
|
| Q |
260 |
aaaatttgttactatgctctatct |
283 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47112749 |
aaaatttgttactatgctctatct |
47112726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University