View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11244_low_5 (Length: 241)
Name: NF11244_low_5
Description: NF11244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11244_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 53 - 228
Target Start/End: Original strand, 33600018 - 33600193
Alignment:
| Q |
53 |
gaaatacgtctaggtgctcacgagcagaaattgactcgcggtagcattgattgaactaatcaaagactgaatttttaagagaaattcagatacagaattc |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33600018 |
gaaatacgtctaggtgctcacgagcagaaattgactctcggtagcattgattgaactaatcaaagactgaatttttaagagaaattcagatacagaattc |
33600117 |
T |
|
| Q |
153 |
ttccaggtttcaagcacggtgcttcacaaatcagaacaaagctggcagagtttggcatgactatgttgctgaaagt |
228 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33600118 |
ttctaggtttcaagcacggtgcttcacaaatcagaacaaagctggcagagtttggcatgactatgttgctgaaagt |
33600193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University