View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11246_high_4 (Length: 309)
Name: NF11246_high_4
Description: NF11246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11246_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 20 - 298
Target Start/End: Complemental strand, 25683199 - 25682921
Alignment:
| Q |
20 |
actattatcaagaacctcgtgattgatagaaaatgaaaagcaatttttccttttccatgcctttgttgagatgagtcatgcacgatccatgcatgcaaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25683199 |
actattatcaagaacctcgtgattgatagaaaatgaaaagcaatttttccttttccatgcctttgttgagatgagtcatgcacgatccatgcatgcaaag |
25683100 |
T |
|
| Q |
120 |
aagatgcttcacacggttacgcacgagtgaggaatgaaaaaggtacgtattgttttgccatctaccaaaatgcactctttttgaacctaaaaggaattga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25683099 |
aagatgcttcacacggttacgcacgagtgaggaatgaaaaaggtacgtattgttttgccatctaccaaaatgcactctttttgaacctaaaaggaattga |
25683000 |
T |
|
| Q |
220 |
agaatatatagacacagagagaggaaaattaatgagaaaaattatatgaatgtaagtttcaatacttgcatatattcat |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25682999 |
agaatatatagacacagagagaggaaaattaatgagcaaaattaaatgaatgtaagtttcaatacttgcatatattcat |
25682921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University