View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11247_high_19 (Length: 317)
Name: NF11247_high_19
Description: NF11247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11247_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 85 - 306
Target Start/End: Complemental strand, 39627286 - 39627065
Alignment:
| Q |
85 |
gttgagaaaatttagagaattaacttaaaaaatggttatgaatcttacaattcatatgaactaccaaattacaagttggtgttgtatatgtcataatacg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39627286 |
gttgagaaaatttagagaattaacttaaaaaatggttatgaatcttacaattcatatgaactaccaaattacaagttggtgttgtatatgtcataatacg |
39627187 |
T |
 |
| Q |
185 |
agtcatcactgactcgttacgagcaatcccgtgcttagagcactggtcactacactagtattgttaatagaaaccatcgtttctccatagtaactcactg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39627186 |
agtcatcactgactcgttacgagcaatcccgtgcttagagcactggtcactacactagtattgttaatagaaaccatcgtttctccatagtaactcactg |
39627087 |
T |
 |
| Q |
285 |
tctcatctccgattgtttctct |
306 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39627086 |
tctcatctccgattgtttctct |
39627065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University