View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11247_high_20 (Length: 276)
Name: NF11247_high_20
Description: NF11247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11247_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 38052762 - 38053020
Alignment:
| Q |
1 |
aagggtgagtttgatttagatgctgattttgattttgataaggtactatactcatgtcaatatgctgagtgtccacaaagtgatttgtgcatgggatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052762 |
aagggtgagtttgatttagatgctgattttgattttgataaggtactatactcatgtcaatatgctgagtgtccacaaagtgatttgtgcatgggatttt |
38052861 |
T |
|
| Q |
101 |
cagacaaaagttcaagggtgaaccatgaatcactctgttcttacagaacagaacaaggacatgttcccttccatgattttctgtcagatgattggttgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052862 |
cagacaaaagttcaagggtgaaccatgaatcacactgttcttacagaacagaacaaggacatgttcccttccatgattttctgtcagatgattggttgaa |
38052961 |
T |
|
| Q |
201 |
tatggatatagcaggggatgatgttaatgagtcgggagagattgtggatatgacattag |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052962 |
tatggatatagcaggggatgatgttaatgagtcgggagagattgtggatatgacattag |
38053020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 95 - 217
Target Start/End: Original strand, 41240262 - 41240392
Alignment:
| Q |
95 |
gattttcagacaaaagttcaagggtgaaccatgaatcactctgttcttacagaacagaacaaggac------atgttcccttccatgat--tttctgtca |
186 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||||||| ||||||||||||||||||||| | | ||||||||||||||| | ||| ||| |
|
|
| T |
41240262 |
gattttcaaacaaaagctcaagggtgaaccataaatcactctcttcttacagaacagaacaaggtcttgttaaagttcccttccatgattatctctctca |
41240361 |
T |
|
| Q |
187 |
gatgattggttgaatatggatatagcagggg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41240362 |
gatgattggttgaatatggatatagcagggg |
41240392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 28 - 75
Target Start/End: Original strand, 41240173 - 41240217
Alignment:
| Q |
28 |
tttgattttgataaggtactatactcatgtcaatatgctgagtgtcca |
75 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41240173 |
tttgattttgataag---ctatactcatgtcaatatgctgagtgtcca |
41240217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University