View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11247_high_21 (Length: 268)
Name: NF11247_high_21
Description: NF11247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11247_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 15 - 246
Target Start/End: Original strand, 12550731 - 12550962
Alignment:
| Q |
15 |
atgaaagaaagtcattattgatctggatagatcgagaaagttatctggattggagcactctgacgtctaagatagtaagtgaccaaagagtgtgaggttt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12550731 |
atgaaagaaagtcattattgatctggatagaccgagaaagttatctggattggagcactctgacgtataagatagtaagtgaccaaagagtgtgaggttt |
12550830 |
T |
 |
| Q |
115 |
acgagttgagaaattgtgtaccttgcattgttgtgagaaggattatttatacaatcctagaaaggagctgttgatgcgtaaagggaggaacgttacatat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12550831 |
acgagttgagaaattgtgtaccttgcattgttgtgagaaagagtatttatacaatcctagaaaggagctgttgatgcgtaaagggaggaacgttacatat |
12550930 |
T |
 |
| Q |
215 |
gacacccttcattaatggtgtgctcttgcagc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12550931 |
gacacccttcattaatggtgtgctcttgcagc |
12550962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University