View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11247_high_23 (Length: 257)
Name: NF11247_high_23
Description: NF11247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11247_high_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 45646377 - 45646612
Alignment:
| Q |
1 |
aggaatattcactgttccttgcaattgactattgaatcctgcaatcactgcagcaggtacataaccactgttcttttggaaatgaaccaatcctttagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45646377 |
aggaatattcactgttccttgcaattgactattgaatcctgcaatcactgcagcaggtacataaccactgttcttttggaaatgaaccaatcctttagga |
45646476 |
T |
|
| Q |
101 |
aacacaaatgtttcacccttaacaatagtctttgatatcaaaacattagctgttgttatgaacccaacatctaattgaccttcaagaacataaacaatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45646477 |
aacacaaatgtttcacccttaacaatagtctttgatatcaaaacattagctgttgttatgaacccaacatctaattgaccttcaagaacataaacaatct |
45646576 |
T |
|
| Q |
201 |
cagttgcacgtgggtgagtgtgaggtgggttcagtc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45646577 |
cagttgcacgtgggtgagtgtgaggtgggttcagtc |
45646612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 52 - 231
Target Start/End: Complemental strand, 38013535 - 38013356
Alignment:
| Q |
52 |
agcaggtacataaccactgttcttttggaaatgaaccaatcctttaggaaacacaaatgtttcacccttaacaatagtctttgatatcaaaacattagct |
151 |
Q |
| |
|
||||||||||| || ||||||||||||| ||||| || ||||| || ||||||||| | |||||||| ||||||||||||||| | ||||| ||| |
|
|
| T |
38013535 |
agcaggtacattggcattgttcttttggaagtgaactaagccttttgggaacacaaatatctcacccttgctaatagtctttgatatgagcacattggct |
38013436 |
T |
|
| Q |
152 |
gttgttatgaacccaacatctaattgaccttcaagaacataaacaatctcagttgcacgtgggtgagtgtgaggtgggtt |
231 |
Q |
| |
|
|| ||||||||||||||||||| ||| |||||||| ||| | || | ||| || || ||||||||||||||||||||||| |
|
|
| T |
38013435 |
gtggttatgaacccaacatctagttggccttcaagcacaaacaccacctcggtggcgcgtgggtgagtgtgaggtgggtt |
38013356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University