View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11247_high_24 (Length: 254)
Name: NF11247_high_24
Description: NF11247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11247_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 44623774 - 44623974
Alignment:
| Q |
1 |
gtataggaggaggaagaagtagaaggcgatgacgtggcatgagttggagttggaaagttcatagctggaagaattcttgtttgagtgctttaacaagaag |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44623774 |
gtataggaggaagaagaagtagaaggcgatgacgtggcatgagttggagttggaaagttcatagctggaaaaattcttgtttgagtgctttaacaagaag |
44623873 |
T |
 |
| Q |
101 |
aagtatcgaacccagaagtgaatttgaaggtgataatgataagtttaacc-aactacaattagtatggaggagaatgagttataaacttagcacgtgttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44623874 |
aagtatcgaacccagaagtgaatttgaaggtgataatgataagtttaaccaaactacaattagtatggaggagaatgagttat-aacttagcacgtgttg |
44623972 |
T |
 |
| Q |
200 |
tg |
201 |
Q |
| |
|
|| |
|
|
| T |
44623973 |
tg |
44623974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University