View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11247_high_26 (Length: 245)
Name: NF11247_high_26
Description: NF11247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11247_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 119 - 228
Target Start/End: Complemental strand, 44623188 - 44623079
Alignment:
| Q |
119 |
tgtcatcctaggcgatcaactttctctgtcttctaaacttcaatttattgctcaaaatattttaaactcttgctaaaagttatacttcaacttttcctca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44623188 |
tgtcatcctaggcgatcaactttctctgtcttctaaacttcaatttattgctcaaaacattttaaactcttgctaaaagttatacttcaacttttcctca |
44623089 |
T |
 |
| Q |
219 |
tgcatttttt |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
44623088 |
tgcatttttt |
44623079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 44623713 - 44623641
Alignment:
| Q |
1 |
ctctcatgtaattctttatcgcataagtgcttatttataagctgtttttgtaacaaacttaaattgtcttcat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44623713 |
ctctcatgtaattctttatcgcataagtgcttatgtataagctgtttttgtaacaaacttaaattgtcttcat |
44623641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University