View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11247_high_29 (Length: 240)
Name: NF11247_high_29
Description: NF11247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11247_high_29 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 24700982 - 24700765
Alignment:
| Q |
18 |
gattaaatgtgtttaatcatgtttttgaa-tctcatcgttatcgatattttgttcattgcttttctgtatatttgtatgtgatacaatatatacattttc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24700982 |
gattaaatgtgtttaatcatgtttttgaaatctcatcgttatcgatattttg------gcttttctgtatatatgtatgtgatacaatatatacattttc |
24700889 |
T |
 |
| Q |
117 |
aatatcgacactgtgtttgattcgaaagactggttttagttgcatatatgtgatgtattgtgtgcattcataattttgattatgatcattgaaatatttt |
216 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24700888 |
aatatcgacactgtgtttgattgaaaaggctggttttatttgcatatatgtgatgtattgtgtgcattcataattttgattatgatcgttgaaatatttt |
24700789 |
T |
 |
| Q |
217 |
agtttgtttcgatttagatcatat |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24700788 |
agtttgtttcgatttagatcatat |
24700765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University