View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11247_low_17 (Length: 328)

Name: NF11247_low_17
Description: NF11247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11247_low_17
NF11247_low_17
[»] chr2 (2 HSPs)
chr2 (1-150)||(18629522-18629671)
chr2 (195-271)||(18629713-18629789)


Alignment Details
Target: chr2 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 18629522 - 18629671
Alignment:
1 gatgacattgtcgaagcaaataacaccgatccacgtaccggaacatggagagacgtttggtatccatgttgacaagattttgtctgagtttattaaagat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18629522 gatgacattgtcgaagcaaataacaccgatccacgtaccggaacatggagagacgtttggtatccatgttgacaagattttgtctgagtttattaaagat 18629621  T
101 tgttttagtttaaggagggcttgtgtttctgaaggtgatggttgtgcggt 150  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
18629622 tgttttagtttaaggagggcttgtgtttctgaaggtgatggttgtgcggt 18629671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 195 - 271
Target Start/End: Original strand, 18629713 - 18629789
Alignment:
195 tgctgttggcagcagtggccattggttgttttgccagctgccgaggatgtttggagaccgttggtcggagaggttaa 271  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18629713 tgctgttggcagcagtggccattggttgttttgccagctgccgaggatgtttggagaccgttggtcggagaggttaa 18629789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University