View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11247_low_17 (Length: 328)
Name: NF11247_low_17
Description: NF11247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11247_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 18629522 - 18629671
Alignment:
| Q |
1 |
gatgacattgtcgaagcaaataacaccgatccacgtaccggaacatggagagacgtttggtatccatgttgacaagattttgtctgagtttattaaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18629522 |
gatgacattgtcgaagcaaataacaccgatccacgtaccggaacatggagagacgtttggtatccatgttgacaagattttgtctgagtttattaaagat |
18629621 |
T |
 |
| Q |
101 |
tgttttagtttaaggagggcttgtgtttctgaaggtgatggttgtgcggt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18629622 |
tgttttagtttaaggagggcttgtgtttctgaaggtgatggttgtgcggt |
18629671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 195 - 271
Target Start/End: Original strand, 18629713 - 18629789
Alignment:
| Q |
195 |
tgctgttggcagcagtggccattggttgttttgccagctgccgaggatgtttggagaccgttggtcggagaggttaa |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18629713 |
tgctgttggcagcagtggccattggttgttttgccagctgccgaggatgtttggagaccgttggtcggagaggttaa |
18629789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University