View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11247_low_22 (Length: 259)

Name: NF11247_low_22
Description: NF11247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11247_low_22
NF11247_low_22
[»] chr5 (1 HSPs)
chr5 (1-249)||(24700214-24700461)


Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 24700461 - 24700214
Alignment:
1 atttgataaaggtattacttcttggaacaattcatgaattaaatacaccgtgaaatcagttttgatttggcaattagagtaacatacggatggcatattt 100  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||    
24700461 atttgataaaggtattatttcttggaacaattcatgaattaaatacaccgtgaaatcagttttgatttggcaattagagtaacaaacggatggcatactt 24700362  T
101 tgttttgatttcagtttaaatagccacgaatatagtgaacacttttgaatatgattcaaattttatctcctgtaagcatgagttgttcacggttctgtat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24700361 tgttttgatttcagtttaaatagccacgaatatagtgaacacttttgaatatgattcaaattttatctcctgtaagcatgagttgttcacggttctgtat 24700262  T
201 aacataagatgtatacatgatttatttgtcccgatctgttttggttcat 249  Q
     ||||||||||||||||||||||||||||| ||||||||||||||||||    
24700261 -acataagatgtatacatgatttatttgtctcgatctgttttggttcat 24700214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University