View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11247_low_25 (Length: 250)
Name: NF11247_low_25
Description: NF11247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11247_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 34906553 - 34906742
Alignment:
| Q |
1 |
atttcgagtatgtcttgatgaaaatcaattttccttagaagtggaggaaatgaattttggaatgtgtaactacagcttgaagatctgtatattagtattt |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
34906553 |
attttgagtatgtcttgatgaaaatcaattttccttagaagtggaggaaatgaattttggaatgtgtaactacagcttgaacatatgtatattagtattt |
34906652 |
T |
|
| Q |
101 |
tgaacacgtttcatatcaattttatgtcataaattggatgaatgatgaatgcgtttgaaatttggttaaatatcataaatcttttagcacg |
191 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
34906653 |
tgaacacgtttcatatc-attttatgtcataaattgggagaatgatgaatgcgtttgaaatttggctaaatatcataaattttttagcacg |
34906742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 95 - 151
Target Start/End: Complemental strand, 15187203 - 15187146
Alignment:
| Q |
95 |
gtattttgaacacgtttcatatcaattttatgtcataaa-ttggatgaatgatgaatg |
151 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||| |||| |||| |||||||| |
|
|
| T |
15187203 |
gtattttgaacacgttttgtgtcaattttatgtcataaatttgggtgaaagatgaatg |
15187146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 238
Target Start/End: Original strand, 38320058 - 38320114
Alignment:
| Q |
182 |
ttttagcacgaaaaaatcgttcatgaaattatgagatttctatgaattgttatttct |
238 |
Q |
| |
|
||||||||| ||||| || ||||||||| ||||| |||||||| |||||||||||| |
|
|
| T |
38320058 |
ttttagcacaaaaaagtctttcatgaaaatatgatatttctatatattgttatttct |
38320114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 49418236 - 49418276
Alignment:
| Q |
182 |
ttttagcacgaaaaaatcgttcatgaaattatgagatttct |
222 |
Q |
| |
|
|||||||| ||||||||| ||||||||| |||||||||||| |
|
|
| T |
49418236 |
ttttagcatgaaaaaatctttcatgaaaatatgagatttct |
49418276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University